БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов...


^ БИБЛИОГРАФИЧЕСКИЙ Перечень

1. Raj, N. Introduction the evolving role of biphosphonate therapy in multiple myeloma/ N. Raj, K C. Anderson // Blood. — 2000. — Vol. 109. — P. 381–383.

2. Ostioblast stimulation in multiple myeloma lacking lytic bone lesions/ R. bataille БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... [et al.] // Br J Hemotol. — 1990. — Vol. 56. — P. 484–487.

Поступила 07.09.2009

УДК [575.224.2+571.1]:618.19-006.04(476.2)-071

^ ОЦЕНКА Наследной Расположенности

К РАКУ МОЛОЧНОЙ ЖЕЛЕЗЫ Средством ТЕСТИРОВАНИЯ Более

Нередких МУТАЦИЙ ГЕНОВ BRCA1 И BRCA2 В ГРУППЕ ПАЦИЕНТОК

^ ИЗ ГОМЕЛЬСКОГО РЕГИОНА БЕЛАРУСИ

А. Е. Силин, В. Н БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов.... Мартинков, Д. Б. Родько,

Э. А. Надыров, С. М. Мартыненко, И. Б. Тропашко

Республиканский научно-практический центр радиационной медицины

и экологии человека, г. Гомель

^ Гомельский областной клинический онкологический диспансер

Проведенная работа отдала возможность в первый раз обрисовать БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... наследственно обусловленные случаи РМЖ в Гомельском регионе Беларуси, определив диапазон и частоты встречаемости более важных генетических причин, лежащих в базе данной патологии.

В итоге молекулярно-генетического исследования 667 первичных случаев РМЖ показано, что БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... из восьми всераспространенных в Восточной Европе мутаций генов BRCA1/2 в Гомельском регионе Беларуси с разными частотами встречаются 5 мутаций — 185delAG, 300T>G, 4153delA, 5382insC и 6174delT. Мутации 2274insA, 3819del5 и 3875del4 в изученной группе БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... отсутствовали. Преобладающей в изучаемом регионе является мутация 5382insC, толика которой составила 80% от всех выявленных мутаций. Суммарная частота мутаций в неселектированной выборке с учетом стандартизованных характеристик возрастной структуры составила 7,9 %.

Установлено, что БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... более весомым аспектом исходя из убеждений оценки вероятности наличия в генотипе мутаций BRCA1/2 является домашний анамнез. В объединенной подгруппе пациенток с любым из главных признаков домашнего рака и их сочетаний толика мутаций составила 24,4 %.

Ключевики БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов...: рак молочной железы, наследная расположенность, генетическое тестирование, BRCA1/2.

^ ESTIMATION OF GENETIC PREDISPOSITION TO BREAST CANCER

BY TESTING OF MOST FREQUENT MUTATIONS OF BRCA1 AND BRCA2 GENES

IN GROUP OF PATIENTS FROM БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... GOMEL REGION OF BELARUS

A. E. Silin, V. N. Martinkov, D. B. Rodjko,

E. A. Nadyrov, S. M. Martynenko, I. B. Tropashko

Republican Research Center for Radiation Medicine and Human Ecology, Gomel

Gomel Regional Clinical Oncologic Dispensary

The work БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... that has been carried out describes for the first time the hereditary caused breast cancer cases in Gomel region of Belarus, having defined a spectrum and frequencies of the most БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... significant genetic factors underlying the given pathology.

After the molecular-genetic testing of 667 primary breast cancer cases it was shown that out of eight BRCA1/2 gene mutations that are widely spread in БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... Eastern Europe there are only five ones in Gomel region of Belarus with various frequencies — 185delAG, 300T>G, 4153delA, 5382insC and 6174delT. The 2274insA, 3819del5 and 3875del4 mutations were not found in БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... the studied group. The 5382insC mutation was found to be the predominant one, which has мейд 80 % of all the detected mutations. Total mutation frequency in nonselective sampling taking into consideration the standardized indicators БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... of age structure has мейд 7,9 %.

It was found out, that family anamnesis is the most significant criterion from the point of view of probability estimation of BRCA1/2 mutations in genotype БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов.... In the united subgroup of patients with any of the basic signs of family cancer and their combinations, the share of mutations has мейд 24,4 %.

^ Key words: breast cancer, genetic predisposition, genetic testing, BRCA1/2.



Введение

Рак молочной БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... железы (РМЖ) является одним из часто встречающихся онкологических болезней и одной из ведущих обстоятельств погибели от рака посреди дам. Раз в год в мире фиксируется около 1 млн. новых случаев БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... РМЖ. В Беларуси данная патология составляет более 17 % от общего числа онкологических болезней, регистрируемых у дам. Посреди причин, определяющих развитие рака молочной железы, особенное место занимает генетическая расположенность. Одним из значимых достижений в области исследования БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... наследной расположенности к РМЖ явилось открытие генов BRCA1 и BRCA2 (BRCA1/2), герминальные мутации которых определяют высшую степень риска появления РМЖ.

Мутации гена BRCA1 определяют до 87 % риска развития РМЖ в возрасте до 70 лет БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... и 50 % в возрасте до 50 лет [1]. Риск развития рака яичников (РЯ) при всем этом добивается 44 % [2]. Мутации гена BRCA2 определяют до 35 % бессрочного риска развития РМЖ [3].

Зависимо от географического местоположения и этнического состава популяции частота мутаций БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... BRCA1/2 колеблется от 0,5 до 15 % в группе пациенток с первичными вариантами РМЖ. С момента открытия медицинской значимости мутаций генов BRCA1 и BRCA2 проведено огромное количество исследовательских работ в почти всех БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... странах мира. Показано, что встречаемость мутаций значимо выше в группах пациенток с признаками домашнего РМЖ — ранешний возраст манифестации, первичномножественное проявление, наличие в семейном анамнезе 2 и поболее случаев РМЖ и (либо) РЯ. Не считая этого, выявлена БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... завышенная частота герминальных мутаций в неких этнических группах. Так, к примеру, в этнической подгруппе евреев-ашкенази (евреи-выходцы из Восточной Европы) в общей популяции суммарная частота 2-ух мутаций 185delAG, 5382insC БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... гена BRCA1 и одной мутации 6174delT гена BRCA2 добивается 2 %, что свидетельствует о ярко выраженном «эффекте основателя» [4, 5]. Посреди славянского населения на восточно-европейской местности и в Сибири преобладающей является мутация 5382insC, в то БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... время как в северо-западной Европе она встречается очень изредка [6–10].

Таким макаром, для организации генетического консультирования в части выявления наследной расположенности к РМЖ, обусловленной мутациями генов BRCA1/2, нужно учесть особенности географического, этнического распространения мутаций БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... и их доминирования в группах с признаками домашнего РМЖ.

По результатам разных исследовательских работ для восточно-европейских популяций выявлен соответствующий диапазон мутаций генов BRCA1 и BRCA2. К более нередко выявляемым БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... мутациям относятся 185delAG, 2274insA, 4153delA, 3819del5, 3875del4, 5382insC и 300T>G, которые локализованы в границах гена BRCA1 и 6174delT — в гене BRCA2. Но диапазон и частоты встречаемости данных мутаций варьируют зависимо от исследуемого региона БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... и изучаемой группы.

Целью данной работы является оценка частот встречаемости более важных для восточно-европейской популяции мутаций генов BRCA1 и BRCA2 в группе пациенток с первичными вариантами РМЖ, живущих БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... в Гомельском регионе Беларуси.

Материал и способ

Группа исследования сформирована из пациенток с первичными вариантами РМЖ без учета каких-то признаков домашнего рака либо дела к этнической подгруппе евреев-ашкенази. В нее на БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... добровольческих началах после подписания формы информированного согласия вошли 667 пациенток с установленным диагнозом РМЖ, которые в период 2004–2009 гг. проходили исцеление в учреждении «Гомельский областной клинический онкологический диспансер». Включение дам в исследование и взятие у их био БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... материала для молекулярно-генетического анализа происходило только после получения их письменного информированного согласия в согласовании со специальной формой, утвержденной Комитетом по этике ГУ «РНПЦ РМиЭЧ». Сбор первичной инфы производил врач БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов...-онко-лог по специально разработанной анкете. Каждой пациентке, согласившейся принять роль в исследовании, было предложено ответить на ряд вопросов, касающихся выяснения домашней истории заболевания и государственной принадлежности. Осуществлялся также сбор медицинской инфы БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов....

Материалом для генетического анализа служила венозная кровь, забор которой производили у пациентов в объеме 1 мл. Кровь помещали в центрифужную пробирку 1,5 мл, содержащую 100 мкл 0,5 М ЭДТА (финишная концентрация 50 мМ). Хранение образцов крови до выделения ДНК БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... выполнялось в холодильной камере при 2–4°С.

Выделение и чистка препаратов ДНК осуществлялась с внедрением готовых наборов Wizard Genomic DNA Purification Kit (Prоmega, США) и «ДНК-сорб-В» (ФГУН «Центральный НИИ эпидемиологии», РФ БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов...) в согласовании с прилагаемыми инструкциями.

Выбор тестируемых мутаций основывался на литературных данных, из которых следует, что в странах Восточной Европы (Польша, Чехия, Латвия, ряд регионов Рф) по результатам анализа огромного количества БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... разных мутаций генов BRCA1 и BRCA2 выявлено доминирование нескольких мутаций. К их числу относятся семь мутаций, локализованных в гене BRCA1 — 185delAG (экзон 2), 300 T>G (экзон 5), 2274insA (экзон 11G), 3819del5 (экзон БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... 11О), 3875del4 (экзон 11О), 4153delA (экзон 11Р) и 5382insC (экзон 20) и одна в гене BRCA2 — 6174delT (экзон 11) [11–13, 6–10]. Тестирование этих мутаций и легло в базу нашего исследования.

Молекулярно-генетический анализ всех мутаций, не считая 300 T БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов...>G, осуществлялся способом гетеродуплексного анализа с внедрением ПЦР. Для проведения ПЦР использовали два специфичных праймера (Forward и Revers), фланкирующих анализируемый кусок ДНК, снутри которого локализована разыскиваемая мутация. Главные свойства использованных в работе БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... праймеров представлены в таблице 1.

Мутация 300T>G тестировалась средством анализа длины рестрикционных фрагментов RFLP-PCR. Для этого на первом шаге осуществлялась ПЦР со специфичными праймерами, а на втором шаге ампликоны подвергали рестрикции ферментом БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов...-рестриктазой AvaII (Fermentas). Данная мутация сформировывает специфичный для этого фермента веб-сайт рестрикции.

В качестве положительного контроля применены эталоны ДНК гетерозиготных носителей разыскиваемых мутаций, приобретенные от М. Ю. Мандельштама (Лаборатория БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... биохимической генетики отдела молекулярной генетики Института экспериментальной медицины РАМН, Санкт-Петербург, Наша родина).

ПЦР производили с внедрением GeneAmp 2400 PCR System (Perkin-Elmer). Смесь реагентов для проведения одной реакции в объеме 25 мкл БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... формировалась последующим образом: 2,5 мкл 10Hot Start ПЦР буфер (200 мM Трис-HCl pH 8,3, 200 мM KCl, 50 мM (NH4)2SO4), 1 мкл 10 мM консистенции dNTP, 0,1 мкл каждого 100 мкM праймера, 3,5 мкл 25 мM MgCl2, 0,1 мкл Hot Start Taq-полимеразы (5 ед БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов..../мкл), 1 мкл эталона ДНК, вода ПЦР-качества до объема 25 мкл.

При каждом проведении ПЦР употреблялся также отрицательный контроль, т. е. в одну из пробирок помещалась полная смесь реагентов для ПЦР, но не БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... вносился эталон ДНК.

Таблица 1 — Перечень олигонуклеотидных праймеров для амплификации анализируемых экзонов BRCA1 и BRCA2

Ген, экзон

Тестируемая

мутация

Заглавие

праймера

Нуклеотидная последовательность,

5’-3’

Размер куска

BRCA1

Экзон 2

185delAG

185-F

GAAGTTGTCATTTTATAAACCTTТ

258 п.н.

185-R

TGTCTTTTCTTCCCTAGTATGT

BRCA1

Экзон 5

300T>G

5-F

CTCTTAAGGGCAGTTGTGAG

200 п.н.

5-R

TTCCTACTGTGGTTGCTTCC

BRCA1

Экзон 11G

2274insA

11G БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов...-F

GCAACTGGAGCCAAGAAGAGTAAC

319 п.н.

11G-R

CCTGAGTGCCATAATCAGTACCAGG

BRCA1

Экзон 11O

3819del5

3875del4

11O-F

GAGTCCTAGCCCTTTCACCCATAC

289 п.н.

11O-R

GTGATGTTCCTGAGATGCCTTTG

BRCA1

Экзон 11P

4153delA

11P-F

AAAGCCAGGGAGTTGGTCTGAG

188 п.н.

11P-R

GTGCTCCCAAAAGCATAAA

BRCA1

Экзон 20

5382insC

5382-F

ATATGACGTGTCTGCTCCAC

257 п.н.

5382-R

AGTCTTACAAAATGAAGCGG

BRCA2

Экзон 11

6174delT

6174-F

CACCTTGTGATGTTAGTTTGGA

201 п.н.

6174-R

TGGAAAAGACTTGCTTGGTACT




Амплификацию куска экзона 20 BRCA1 (мутация 5382insC) проводили БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... по последующей программке: исходная денатурация — 4 мин при 94°С, потом 10 циклов 10-секундной денатурации при 92°С, отжиг — 20 сек при 68°С и элонгация 20 сек при 72°С при уменьшении температуры отжига на 1,5°С в каждом следующем цикле. Последующие 30 циклов БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... — 10 сек денатурация при 94°С, 30 сек отжиг при 57°С и 30 сек элонгация при 72°С. В окончании — финишная элонгация 5 мин при 72°С и остывание до 4°С.

Программка для амплификации фрагментов экзона 2 BRCA1 (мутация БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... 185delAG) и 11 BRCA2 (мутация 6174delT) смотрелась последующим образом: исходная денатурация — 4 мин при 94°С, потом 35 циклов — 10 сек денатурация при 94°С, 30 сек отжиг при 59°С и 30 сек элонгация при 72°С. В окончании БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... — финишная элонгация 5 мин при 72°С и остывание до 4°С.

Амплификацию 3-х фрагментов экзона 11 BRCA1 (мутации 3819del5, 3875del4, 2274insA и 4153delA) проводили по последующей программке: исходная денатурация — 4 мин при 94°С, потом 35 циклов — 10 сек денатурация при 94°С БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов..., 30 сек отжиг при 55°С и 30 сек элонгация при 72°С. В окончании — финишная элонгация 5 мин при 72°С и остывание до 4°С.

Амплификацию куска экзона 5 BRCA1 (мутация 300Т>G) производили по последующей программке: исходная БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... денатурация — 4 мин при 94°С, потом 35 циклов — 10 сек денатурация при 94°С, 30 сек отжиг при 60°С и 30 сек элонгация при 72°С. В окончании — финишная элонгация 5 мин при 72°С и остывание до БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... 4°С. Следующая рестрикция ампликонов осуществлялась средством фермента-рестриктазы AvaII, входящей в набор FastDigest AvaII (Eco47I) (Fermentas). Рестрикцию проводили 5 мин при температуре 37°С в согласовании с прилагаемой аннотацией.

Электрофорез и расцветку гелей проводили БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... в специальной электрофоретической системе MultiphorII (GE). В работе применялись 12 % полиакриламидные неденатурирующие гели шириной 1 мм. Расцветка осуществлялась с внедрением нитрата серебра. Маркерами молекулярного веса являлись куски ДНК из набора «50pb DNA Step Ladder БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов...» (Promega), масса которых составляла 50–800 пар нуклеотидов с шагом в 50 п.н.

Факты выявленных мутаций выборочно подтверждались секвенированием с внедрением прибора ABI Prism 310 Genetic Analyzer.

Результаты и обсуждение

Молекулярно-генетический анализ 667 образцов ДНК выявил 75 случаев БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... герминальных мутаций генов BRCA1 и BRCA2, что составляет 11,2 ± 1,2 % от всех проанализированных случаев РМЖ. При всем этом в 60 случаях найдена мутация 5382insC (9,0 ± 1,1 %). В 5 случаях найдена мутация 185delAG (0,8 ± 0,3 %). По 4 варианта РМЖ аккомпанировали БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... мутации 4153delA и 300T>G (0,6 ± 0,3 % для каждой из мутаций), а в 2 случаях — 6174delT (0,3 ± 0,2 %). Другие анализируемые мутации в исследуемой выборке отсутствовали. Толика преобладающей мутации 5382insC составила 80 % от всех выявленных мутаций.

Не считая перечисленных выше мутаций, при БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... анализе 5 экзона гена BRCA1 в одном образчике ДНК на электрофореграмме сформировалась соответствующая гетеродуплексная структура. В итоге секвенирования данного эталона выявлена мутация, приводящая к подмене цитозина на тимин в положении 273 (набросок 1). В БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... базе данных BIC (The Breast Cancer Information Core Database) эта мутация обозначена как 273С>T (L52F). В связи с отсутствием в текущее время инфы о медицинской значимости данной мутации она не учитывалась БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... в предстоящем анализе.




^ Набросок 1 — Результаты секвенирования куска 5 экзона гена BRCA1

в образчике ДНК, содержащем мутацию 273C>T



Примеры электрофоретической детекции 8 анализируемых мутаций представлены на рисунке 2.

Сопоставляя приобретенные нами данные с плодами других исследовательских БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... работ по неселектированным группам пациенток с РМЖ из разных географических регионов мира, необходимо подчеркнуть приметное превышение суммарной частоты выявленных мутаций генов BRCA1 и BRCA2 в изучаемой выборке Гомельского региона БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов..., которая в других популяциях обычно составляет 3–6 %.





^ Набросок 2 — Результаты электрофоретического фракционирования

амплифицированных фрагментов в 12 % неденатурирующем полиакриламидном геле

Дорожки 1 и 45 — маркер молекулярной веса; дорожки 2–6, 8–12, 14–18, 20–24, 27–31, 33–37, 39–43 — ампликоны анализируемых экзонов BRCA1 и BRCA2 без мутации; дорожка 7 — ампликон с мутацией 185delAG БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов...; дорожка 13 — ампликон с мутацией 6174delT; дорожка 19 — ампликон с мутацией 5382insC; дорожка 25 — ампликон с мутацией 3819del5; дорожка 26 — ампликон с мутацией 3875del4; дорожка 32 — ампликон с мутацией 4153delA; дорожка 38 — ампликон с мутацией 2274insA; дорожка БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... 44 — ампликон с мутацией 300T>G



Одним из разъяснений высочайшей частоты мутаций может быть диспропорциональная представленность в исследовании возрастных групп, соответствующих для случаев РМЖ в Беларуси. Для получения стандартизованного показателя суммарной частоты мутаций был проведен сравнительный БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... анализ возрастных структур подборки данного исследования и Республики Беларусь в целом. В расчете применены все случаи РМЖ в Беларуси за период 1997–2007 гг. Результаты проведенного сопоставления представлены на рисунке 3.

На нем отлично видно, что БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... группа исследования оказалась смещенной в сторону относительно юных возрастов. В этой ситуации можно ждать завышенную частоту мутаций BRCA1/2, так как для клинически неблагоприятных генотипов данных генов характерен более ранешний БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... возраст манифестации.



^ Набросок 3 — Сопоставление возрастных структур заболевших дам в исследуемой группе

и Республике Беларусь (расчет по всем случаям РМЖ за период 1997–2007 гг.)



Стандартизованный показатель суммарной частоты выявленных мутаций, который был рассчитан с учетом различий БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... в сравниваемых возрастных структурах, значительно снизился и составил 7,9 %. Выявленная нами суммарная частота мутаций в целом соответствует приобретенной ранее для белорусской популяции, где она по результатам тестирования 3-х мутаций BRCA1/2 (5382insC, 300T>G и 6174delT БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов...) в неселектированной группе пациенток с РМЖ была равна 6% [14].

Таким макаром, проведенное исследование установило, что около 8 % первичных случаев РМЖ в Гомельской области связаны с присутствием в генотипах пациенток 5 разных клинически важных БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... мутаций генов BRCA1 и BRCA2.

Принципиальной исходя из убеждений генетического консультирования является информация о частотах мутаций генов BRCA1/2, которые можно ждать у пациенток с любым одним либо несколькими признаками домашнего рака, также принадлежности БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... к этнической подгруппе евреев-ашкенази. Эта информация с учетом региональных особенностей позволит более отлично сформировывать группы с завышенной вероятностью присутствия клинически неблагоприятных генотипов BRCA1/2 для следующего молекулярно-генетического анализа.

Нами БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... проведен сравнительный анализ частот встречаемости выявленных мутаций в подгруппах пациенток, сформированных в границах неселектированной группы исследования с учетом главных признаков домашнего рака и принадлежности к этнической подгруппе евреев-ашкенази, разных композиций признаков БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов..., также без таких признаков. Результаты проведенного анализа представлены в таблице 2.

На основании данных таблицы 2 можно сделать заключение, что более весомым аспектом высочайшего риска наличия в генотипе мутаций генов BRCA1/2 является домашняя история заболевания. Посреди подгрупп БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов..., сформированных с учетом только 1-го аспекта домашнего рака, толика пациентов с мутациями в подгруппе с отягощенным семейным анамнезом составила 26,4 %, в то время как в подгруппах с ранешней манифестацией и первичномножественным проявлением она БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... равнялась 19,4 и 15,8 % соответственно.

Приметной является высочайшая частота выявленных мутаций в подгруппах с 2-мя разными признаками домашнего рака. Так, к примеру, в подгруппе «Ранний возраст манифестации+Первичномножественное проявление» толика пациенток с мутациями БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... добивается 45,5 %. Более высочайшая частота мутаций выявлена в подгруппе с 3-мя признаками домашнего рака. В то же время очень малая численность данной подгруппы не позволяет сделать окончательные выводы.

В исследовании приняли роль также пациентки БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов..., которые в итоге анкетного опроса признали себя лицами еврейской национальности. Посреди этой подгруппы из 6 пациенток выявлены две разные мутации (33,3 %).

В объединенной подгруппе пациенток, сформированной с учетом наличия хоть какого из признаков БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... домашнего рака, их сочетаний и (либо) дела к этнической подгруппе евреев-ашкенази, толика выявленных мутаций генов BRCA1/2 составила 24,4 %.

Направляет на себя внимание довольно огромное количество выявленных мутаций в подгруппе без какого БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов...-нибудь из рассматриваемых признаков. В границах этой группы, насчитывающей 429 пациенток, выявлено 17 случаев наличия в генотипе клинически важных мутаций гена BRCA1, что составляет более 23 % от всех выявленных в исследовании мутаций. Толика BRCA-положительных пациенток в БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... этой подгруппе составила 4 %. Настолько высочайшие значения частот мутаций в подгруппе, которая может рассматриваться как группа спорадических случаев РМЖ, разумеется, отражает определенную некорректность в формировании подгрупп на базе результатов анкетирования БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов.... В особенности это касается сбора инфы о семейном анамнезе. Признанным является факт пониженной достоверности инфы о домашней истории заболевания, приобретенной в итоге опроса пациенток. Пробанд может не знать родственников, перенесших болезнь из-за их БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... ранешней погибели и (либо) утраты инфы [15]. Также может быть искажена либо отсутствовать информация о локализации рака. Трудности выяснения домашней истории есть по отцовской полосы родства, так как обычно в данном случае БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... РМЖ либо РЯ выслеживается у более отдаленных родственников. В любом случае данный факт следует учесть при организации работ по выявлению лиц, имеющих наследную расположенность к РМЖ.

Таблица 2 — Сравнительный анализ частот мутаций в разных БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... подгруппах

Группы

К-во

пациен-

тов

Выявленные мутации

Всего

Суммарная

частота

мутаций

в группе, %

5382insC

185delAG

4153delA

300T>G

6174delT

Неселектированная группа исследования

667

60

5

4

4

2

75

11,2%

Ранешний возраст манифестации (≤40 лет), включая другие признаки

91

17

2

1

3

0

23

25,3%

Ранешний возраст манифестации (≤40 лет)

с исключением других признаков

67

8

2

1

2

0

13

19,4%

Манифестация в возрасте > 40 лет, включая другие признаки

576

43

3

3

1

2

52

9,0%

Домашний анамнез (один БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... и поболее случаев РМЖ и (либо) РЯ), включая другие признаки

122

33

0

0

1

1

35

28,7%

Домашний анамнез (один и поболее случаев РМЖ и (либо) РЯ) с исключением других признаков

87

22

0

0

1

0

23

26,4%

Без домашней истории заболевания, включая другие признаки

545

27

5

4

3

1

40

7,3%

Первичномножественное проявление, включая другие признаки

67

11

3

0

1

1

16

23,9%

Первичномножественное БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... проявление с исключением других признаков

38

3

3

0

0

0

6

15,8%

Без первичномножественного проявления, включая другие признаки

600

49

2

4

3

1

59

9,8%

Ранешний возраст манифестации + Домашний анамнез

17

7

0

0

0

0

7

41,2%

Ранешний возраст манифестации + Первичномножественное проявление

11

4

0

0

1

0

5

45,5%

Первичномножественное проявление + Домашний анамнез

22

6

0

0

0

1

7

31,8%

Три признака домашнего рака

4

2

0

0

0

0

2

50,0%

Отношение к этнической подгруппе евреев-ашкенази

6

1

0

0

0

1

2

33,3%

Какой-нибудь один из БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... признаков домашнего рака (и их сочетание) либо дела к этнической подгруппе евреев-ашкенази

238

46

5

1

4

2

58

24,4%

Отсутствие каких-то признаков домашнего рака и дела к этнической подгруппе евреев-ашкенази

429

14

0

3

0

0

17

4,0%




Заключение

В итоге проведенного молекулярно-генетического исследования 667 первичных случаев РМЖ показано БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов..., что из восьми всераспространенных в Восточной Европе мутаций генов BRCA1/2 в Гомельском регионе Беларуси с разными частотами встречаются 5 мутаций — 185delAG, 300T>G, 4153delA, 5382insC и 6174delT. Мутации 2274insA, 3819del5 и 3875del БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов...4 в изученной группе отсутствовали. Преобладающей в изучаемом регионе является мутация 5382insC, толика которой составила 80 % от всех выявленных мутаций. Суммарная частота мутаций в неселектированной выборке с учетом стандартизованных характеристик возрастной структуры БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... составила 7,9 %.

Установлено, что более весомым аспектом исходя из убеждений оценки вероятности наличия в генотипе мутаций BRCA1/2 является домашний анамнез. У лиц с 2-мя и 3-мя разными признаками домашнего рака частоты мутаций существенно БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... выше, чем у пациенток с любым одним из признаков. В объединенной подгруппе пациенток с любым из главных признаков домашнего рака и их сочетаний толика мутаций составила 24,4 %.

Проведенная работа отдала возможность в первый БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... раз обрисовать наследственно обусловленные случаи РМЖ в Гомельском регионе Беларуси, определив диапазон и частоты встречаемости более важных генетических причин, лежащих в базе данной патологии.

Приобретенные данные могут быть применены для организации работ БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... по заполнению «Республиканского регистра лиц, имеющих наследную расположенность к злокачественным новообразованиям, и их родственников» в рамках деятельности областных кабинетов онкогенетического консультирования в согласовании с Приказом Министерства здравоохранения РБ №1018 от 27.12.2007 г.

Создатели выражают благодарность заведующему лабораторией БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... эпидемиологии научного отдела ГУ «РНПЦ РМиЭЧ» Масякину В. Б. за помощь при расчете стандартизованного показателя суммарной частоты выявленных мутаций.

Работа выполнена в рамках Гос всеохватывающей программки исследований «Современные клеточные молекулярно БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов...-гене-тические технологии в медицине; новые подходы к регуляции, корректировки (реабилитации) и профилактике патологических состояний человека» (договоры № 14/06-ФИ и №17/09-ФИ).

^ БИБЛИОГРАФИЧЕСКИЙ Перечень

1. Genetic heterogeneity and penetrance analysis of the BRCA l and БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... BRCA 2 genes in breast cancer families / D. Форд [et al.] // Am J Hum Genet. — 1998. — № 62. — P. 676–689.

2. Wjittemore, A. Preralence and contribution of BRCA 1 mutations in hreast cancer and ovarian cancer: resaltsfrom three US populalion-based case БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов...-control studies of ovarian cancer / A. Wjittemore, G. Gong, J. Itnyre // Am J Hum Genet. — 1997. — № 60. — P. 496–504.

3. BRCA 1 mutations in women attending clinics that evaluate the risk of breast cancer / F. J. Couch БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... [et al.] // N. Engl. J. Med. — 1997. — № 336. — P. 1409–1415.

4. The risk of cancer associated with specific mutations of BRCA1 and BRCA2 among Ashkenazi jews / J. Struewing [et al.] // The New England Journal БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... of Medicine. — 1997. — Vol. 336, № 20. — P. 1401–1408.

5. Slatkin, M. A Population-Genetic Test of Founder Effects and Implications for Ashkenazi Jewish Diseases / M. Slatkin // Am. J. Hum. Genet. — 2004. — Vol. 75. — P. 282–293.

6. Frequently Occurring Germ-Line Mutations of the БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... BRCA1 Gene in Ovarian Cancer Families from Russia / S. Gayther [et al.] // Am. J. Hum. Genet. — 1997. — № 60. — P. 1239–1242.

7. Поиск нередко встречающихся мутаций в генах расположенности к раку молочной железы / М. Ю. Мандельштам [и БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... др.] // Генетика. — 2001. — Т. 31, № 12. — С. 1681–1686.

8. Доминирование обширно всераспространенных мутаций в гене BRCA1 у нездоровых семейными формами рака молочной железы Санкт-Петербурга / Н. А. Грудинина [и др.] // Генетика. — 2005. — Т. 41, № 3. — С. 405–410.

9. Наследные БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... мутации при ранешних, семейных и билатеральных формах рака молочной железы у пациенток из Рф / А. П. Соколенко [и др.] // Сибирский онкологический журнальчик. — 2008. — Т. 27, № 3. — С. 43–49.

10. BRCA1 and BRCA2 mutation status and cancer family history of Danish БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... women affected with multifocal or bilateral breast cancer at a young age / J. T. Bergthorsson [et al.] // J. Med. Genet. — 2001. — № 38. — P. 361–368.

11. Founder Mutations in the BRCA1 Gene in Polish БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... Families with Breast-Ovarian Cancer / B. Gorski [et al.] // Am. J. Hum. Genet. — 2000. — № 66. — P. 1963–1968.

12. High proportion of recurrent germline mutations in the BRCA1gene in breast and ovarian cancer patients from the БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... Prague area / P. Pohlreich [et al.] // Breast Cancer Research. — 2005. — Vol. 7, № 5. — P. 728–736.

13. Strong founder effects in BRCA1 mutation carrier breast cancer patients from Latvia / B. Csokay [et al.] // Hum Mutat. — 1999. — Vol. 14, № 92.

14. ДНК-диагностика наследных форм БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... рака молочной железы/ Ю. Н. Леонович [и др.] // Заслуги мед науки Беларуси. — 2008. — Вып. XIII. — С. 85–87.

15. Kerber, R. Slattery Comparison of Self-reported and Database-linked Family History of Cancer Data БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... in a Case-Control Study / R. Kerber, M. Slattery // American Journal of Epidemiology. — 1997. — Vol. 146, №. 3. — P. 244–248.

Поступила 26.07.2009

УДК 616.832-004.2

^ ТЕЧЕНИЕ Растерянного СКЛЕРОЗА

В ГОМЕЛЬСКОЙ ОБЛАСТИ Зависимо от Различных Причин

Ф. В. Багинский, В. Я. Латышева

Гомельская областная клиническая поликлиника

Гомельский БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... муниципальный мед институт

Изложены результаты исследования зависимости развития и течения растерянного склероза от плотности радиоактивного загрязнения и величины населенного пт.

Установлено (с достоверностью 0,68), что в зоне с радиоактивным загрязнением выше 5 Ku/км2 наблюдается БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... более тяжелое течение заболевания, выражающееся в доминировании прогредиентных форм.

Показано, что имеется статистически достоверная тенденция увеличения тяжести течения заболевания в городках с популяцией от 10 до 50 тыщ человек.

Ключевики: растерянный склероз, радиоактивное загрязнение.

^ MULTIPLE БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... SCLEROSIS CURRENT

IN THE GOMEL AREA DEPENDING ON DIFFERENT FACTORS

F. V. Bahinski, V. J. Latysheva

Gomel Regional Clinical Hospital

Gomel State Medical University

Results of research of dependence of development and current of БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... a multiple sclerosis from density of radioactive pollution and size of settlement are stated.

It is established (with reliability 0,68), that in a zone with radioactive pollution from above 5 Ku/км2 heavier current of БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... disease expressed in prevalence of progredient forms is observed.

It is shown, that there is statistically authentic tendency of increase of weight of current of disease in cities with the population from 10 up БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... to 50 thousand person.

^ Key words: multiple sclerosis, radioactive pollution.



Введение

Растерянный склероз (РС) представляет собой хроническое прогрессирующее болезнь ЦНС, поражающее в большей степени лиц юного, более трудоспособного возраста, проявляющееся рассеянной неврологической симптоматикой БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... и нередко приводящее к резвой инвалидизации нездоровых.

РС как отдельная нозологическая единица был выделен Жаном Мартеном Шарко посреди 19 века, хотя этим болезнью люди мучались с глубочайшей древности [1]. Более 150 лет данная патология усиленно изучается БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... спецами различных государств, как клиницистами, так и исследователями в области базовых наук. Еще в довоенное время И. И. Карцовник установил, что развитие этого заболевания может быть связано с нейротравмой [1], но потом эти БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... данные не подтвердились [1]. В послевоенное время при исследовании РС использовали разные подходы. К примеру, В. Д. Тимаков и В. А. Зуев выдвигали идею об заразной природе этого заболевания [2, 3]. Эпидемиологические нюансы этого демиелинизирующего заболевания БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... описаны у многих создателей [6, 8].

С начала 70-х годов XX столетия начато подробное исследование иммунологических качеств появления и предстоящего развития этой патологии [3]. Невзирая на то, что схожее направление разрабатывается уже около БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... 40 лет, способности его не исчерпаны и исследования в этом направлении длятся [4, 5, 9–12]. В последние годы появились и удачно развиваются новые направления в исследовании РС. Так, ряд зарубежных и российских ученых с фуррором БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... употребляют способы молекулярной биологии и молекулярной генетики [5, 13]. Вместе с огромным числом всеохватывающих исследовательских работ появились принципиальные обобщения научных работ по этому заболеванию [1, 6].

В Республике Беларусь заболеваемость РС изучалась В. Я. Латышевой и В. И БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов.... Курман [7]. Проведя исследования огромного количества нездоровых из различных регионов, создатели проявили общую картину распространения этого заболевания в Республике Беларусь. Были выделены районы, пострадавшие от аварии на Чернобыльской АЭС, при этом БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... выявлен определенный рост заболеваемости РС в итоге воздействия Чернобыльской катастрофы. При всем этом из-за переселения людей из грязных районов и воздействия других причин опосредованно воздействие аварии сказалось и в областях, которые БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... были относительно наименее загрязнены радионуклидами.

Невзирая на большой объем исследований, проводимых в мире, вопросы этиологии, патогенеза и способы исцеления РС по сей день остаются нерешенными. А именно, нет окончательного представления о разных факторах БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов..., в том числе и генетических механизмах, влияющих на появление и течение РС. В связи с этим представляет энтузиазм продолжение исследовательских работ о воздействии радиоактивного загрязнения, зоны проживания, величины населенных пт и др. на БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... распространенность РС.

Целью истинной работы явилось исследование зависимости клинических проявлений, тяжести течения заболевания, иммунологической активности во время экзацербации при ремитирующих формах и клинико-лабораторных ухудшениях при прогредиентных формах РС зависимо от района БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... проживания и величины населенного пт.

Материал и способ исследования

Материалом исследования явились нездоровые РС, которые проходили исцеление в неврологическом отделении Учреждения «Гомельская областная клиническая больница» в 2007–2008 гг., поступившие из разных районов БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... Гомельской области: из городов областного подчинения (Жлобин, Мозырь, Светлогорск и др.), из относительно маленьких районных центров (Ельск, Лельчицы и др.), также из сельской местности. Всего было обследовано 62 пациента. По полу они распределены последующим образом БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов...: парней было 15 (24,2 %), дам — 47 (75,8 %). Средний возраст дебюта заболевания составил 34,1 ± 7,9 года. Во время исцеления в неврологическом отделении средний возраст нездоровых был 40,3 ± 9 лет.

Результаты исследовательских работ обработаны современными способами математической статистики [14]. При анализе руководствовались системным подходом БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... к изучаемому явлению с внедрением способов системного анализа [14, 15]. Беря во внимание, что тип течения заболевания при РС представляет собой доброкачественную категорию, а при статистическом анализе целенаправлено учесть количественные характеристики БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов..., нами проведена шифровка характеристик, которым присвоены баллы от 1 (ремитирующее течение) до 4 (прогредиентно-ремитирующее), что рекомендуется при проведении статистического анализа био явлений [14, 15].

Результаты и обсуждение

Беря во внимание, что территория Гомельской области в большей степени БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... посреди других регионов Беларуси пострадала от аварии на Чернобыльской АЭС, нужно было разглядеть воздействие уровня радиоактивного загрязнения на заболеваемость и течение РС. Для этого все районы Гомельской области были разбиты на условно незапятнанные БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... (до 5 Ku/км2) и грязные, где плотность загрязнения была выше. К последним относятся Брагинский, Наровлянский, Ветковский и др. Определено количество случаев в границах каждой зоны загрязнения. Результаты исследования приведены в таблице БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... 1.

Таблица 1 –– Количество нездоровых с различным течением заболевания в радиоактивно грязных и относительно незапятнанных зонах Гомельской области

Тип течения заболевания

Статистические характеристики, n / %

пациенты радиоактивной зоны

пациенты относительно незапятанной зоны

Ремитирующее

1/1,6

14/22,6

Первично прогредиентное

0/0

11/17,8

Вторично прогредиентное

2/3,2

10/16,1

Прогредиентно-ремитирующее

6/9,7

18/29,0

Всего

9/14,5

53/85,5




Как надо из БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... таблицы 1, число нездоровых, живущих на территориях загрязнения радионуклидами, было в 5,9 раза меньше, чем в незапятнанных регионах. Можно считать, что это было обосновано переселением людей юного возраста в незапятнанные регионы. В связи с БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... этим нельзя исключить, что в первый раз выявленные случаи РС были учтены в этих зонах.

Для более углубленного анализа результатов исследования было проведено вычисление t-критерия Стьюдента, что позволяло выявить наличие различий БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... меж незапятанной и грязной зонами (таблица 2).

Согласно данным таблицы 2, установлено, что невзирая на различия типа течения заболевания на 1 балл меж зонами, статистического различия по этому показателю нет. Вычисленный t-критерий Стьюдента показал, что уровень БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... достоверности проведенного анализа лежит в границах одной сигмы, т. е. равен 0,68. Может быть, тут сказался определенный недочет материала по грязным зонам. В то же время приобретенные данные позволяют утверждать, что БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... имеющееся различие нельзя игнорировать, т. к. среднее значение достоверно при высочайшем уровне значимости, а точность исследования, составляющая в среднем около 10 %, довольно высока для подобного рода обследований.

Таблица 2 –– Статистические характеристики типа течения заболевания БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... зависимо от радиоактивного загрязнения

Зона проживания

Статистические характеристики

*

Mx

δ

S

V

P

N

Радиоактивно-загрязненная

3,44

0,32

0,96

0,91

37,5

9,4

9

Незапятнанная

2,60

0,165

1,20

1,45

46,2

11,5

53

Примечание: –– среднее значение; Mx –– ошибка среднего значения; δ –– среднеквадратическое отклонение; S –– дисперсия; V –– коэффициент варианты; P –– точность исследования; N –– число наблюдений



Получены также данные о воздействии величины населенного пт БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... на течение РС. Экспериментальный материал был разбит на три группы: населенные пункты с количеством обитателей до 10 тыс. (малые), от 10 до 50 тыс. человек (средние) и выше 50 тыс. (огромные). При всем этом из числа малых и БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... средних населенных пт исключены те, которые попадают в зону, отнесенную к радиоактивно грязной, т. е. исследование провели для относительно незапятнанных территорий Гомельской области. Рассредотачивание нездоровых по тяжести течения в границах групп населенных БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... пт представлено в таблице 3.

Данные таблицы 3 свидетельствуют о том, что в огромных городках преобладало число случаев с ремитирующим течением (7 случаев), в средних населенных пт –– с прогредиентно-ремитирующим (10 случаев), а в малых БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... –– с вторично прогредиентным (5 случаев). Наибольшее число нездоровых с РС было в городках со средним числом обитателей (18 человек).

Таким макаром, можно утверждать, что число случаев с разным течением РС во всех населенных пт БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... в относительно незапятанной зоне разнится на 4.

Вычисленный t-критерий Стьюдента показал, что его величина наименее 2, другими словами разница относительно не существенна. Несколько более тяжелое течение заболевания наблюдалось в населенных пт со БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... средним числом обитателей, но достоверность этой различия лежит в границах 0,5–0,6 (таблица 4).

Анализируя данные таблицы, можно утверждать, что статистически важного различия меж данными типа течения РС и величиной населенного пт не установлено БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов....

Таблица 3 — Рассредотачивание нездоровых с различным типом течения зависимо от величины населенного пт

Тип течения заболевания

Число случаев РС зависимо от величины населенного пт

огромные

средние

малые

Ремитирующее

7

3

4

Первично прогредиентное

5

3

2

Вторично прогредиентное

4

2

5

Прогредиентно-ремитирующее

6

10

3

Всего

22

18

14

Таблица 4 –– Статистические характеристики типа течения заболевания зависимо от величины населенного пт

Величина БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... населенных пт

Статистические характеристики



Mx

δ

S

V

P

N

Огромные

2,4

0,25

1,2

1,44

49,5

12,4

22

Средние

3,0

0,28

1,2

1,4

38,5

9,6

18

Малые

2,5

0,3

1,12

1,25

44,7

11,2

14




Выводы

Проведенное исследование показало, что в радиоактивно грязной зоне наблюдается несколько более тяжелое течение заболевания, хотя достоверность этого показателя невысока: не превосходит одной сигмы (0,68). Значимой различия в течении заболевания в БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... населенных пт разной величины, расположенных в относительно незапятанной от радиоактивного загрязнения зоне, не установлено. Маленькая тенденция увеличения тяжести течения РС наблюдается в средних городках с популяцией от 10 до 50 тыс. человек. Данный БИБЛИОГРАФИЧЕСКИЙ СПИСОК - В. В. Аничкин (Гомель), С. Б. Мельнов (Минск), М. Е. Абраменко (Гомель), А. Д. Наумов... факт просит дополнительных исследовательских работ и при его доказательстве нуждается в клиническом разъяснении.



biblisovie-nasekomoyadnie-rasteniya.html
bibliya-kak-nauchnij-istochnik-o-sotvorenii-mira-referat.html
bibliya-o-sahadzha-joge-hristianstvo-i-sahadzha-joga.html